Brand new 2.5 gallon kegs were just staring at me

[oneal66]

As soon as I finish bio-engineering my new breed of super-robo-clone turtles, I'll happily outfit the entire BN special ops unit and we can invade Canada. The only thing I'm stuck on is the DNA sequence for a beer tap, and where on the super-robo-clone turtle do I want the beer dispensed.

Here you go:

GCATTAGAATAAACAGCACCA

Now clone me a beer dispensing turtle.

[TMB]

If someone has a schematic I'm sure I could build a prototype DNA sequencer. We could even sequence the genes of all the different yeast strains for Jamil when we're done with the turtles...

[Chris_J]

If someone has a schematic I'm sure I could build a prototype DNA sequencer. We could even sequence the genes of all the different yeast strains for Jamil when we're done with the turtles...

Or we could build a flux capacitor, travel to the future to get said plans, then come back to the present and reap the benefits

[Brew Engineer]

Good news everyone: Today's super-robo-clone turtle experiment went well. I can successfully feed them BMC, and they piss out good beer! So far I've gotten Kolsch, German Pislner, and Ordinary Bitter. I'm having difficulties getting anything darker than a 10 lovibond. My attempt at a chocolate stout turned ugly. In unrelated news, we need a new lab technician... any volunteers???



I predict project success about the same time as Bub releases his Brew-bot.

[Mylo]

I predict project success about the same time as Bub releases his Brew-bot.

Aw, man. Then we've got PLENTY of time. We'll have a hop surplus by then!


Mylo

[bub]

NOT MY BREW BOT...
I'm just the "faceman"
BUB

[SunkenBier]

Ouch, they sure didnt go for looks when they were after a faceman.

[TimmyR]

I'm just the "faceman"

Truly an ironic statement of The BN Army sickness. That's why we love it.